Exercícios

Estrutura e Função dos Ácidos Nucleicos

  1. Quais as diferenças de composição e estrutura entre RNA e DNA. Como se distingue entre a uracila e a timina, e entre a ribose e a desoxirribose.
  2. Escreva os nomes das bases, ribonucleosídeos, desoxirribonucleosídeos, ribonucleotídeos e desoxirribonucleotídeos do DNA e RNA.
  3. Escreva a estrutura da 5' -desoxiadenosina trifosfato (dATP). Especifique o tipo de ligação entre: (a) a base nitrogenada e o açúcar; (b) o açúcar e o fosfato; (c) os fosfatos a , b e g .
  4. Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequência:
  5. (5') ATGCCGTATGCATTGCATTC (3')

    Exprima, em porcentagem, a composição de bases do DNA de fita dupla.

  6. Como são chamadas as ligações covalentes que unem dois nucleotídeos consecutivos nas moléculas de ácidos nucleicos? Esquematize estas ligações.
  7. Uma molécula de ácido nucleico tem a seguinte composição de bases: C = 24,1%; G = 18,5%; T = 24,6% e A = 32,8%. O que se pode afirmar sobre a natureza desta molécula?
  8. RNA é facilmente hidrolizado por álcali, enquanto DNA não o é. Por que?
  9. Explique por que os ácidos nucleicos são desnaturados quando submetidos a alta temperatura o pHs extremos? Como estas moléculas podem ser renaturadas?
  10. Defina Temperatura de fusão (Tm) e efeito hipercrômico.
  11. O valor de Tm para o DNA pode ser calculado usando-se a fórmula :
  12. Tm = 69,3 + 0,41(%GC), onde GC é a porcentagem de Guanina + Citosina

    1. DNA de E. coli contém 50% GC. Calcular o Tm para o DNA desta bactéria.
    2. As curvas de fusão da maioria dos DNAs que ocorrem naturalmente revelam que o Tm é normalmente maior do que 65oC. Por que isto é importante para a maioria dos organismos?
    3. Como varia o Tm com a força iônica da solução?
    4. O que acontece com Tm quando se adiciona etanol à solução de DNA?
  13. Quais as principais características da dupla-hélice de DNA de acordo com o modelo proposto por Watson e Crick?
  14. Combine as características da coluna da direita com o tipo de hélice do DNA da coluna da esquerda.
  15. DNA-A (1) as pirimidinas estão na configuração anti

    DNA-B (2) os fosfatos na cadeia estão em ziguezague

    DNA-Z (3) apresenta uma estrutura helicoidal no sentido levógiro

    (4) apresenta 10,4 pares de bases por volta

    (5) as bases estão inclinadas 20o em relação ao eixo da hélice.

  16. Descreva os principais experimentos que indicaram que o DNA é o material genético.

 

 

14. Combine os organismos listados na coluna da esquerda com o tamanho correto de seus respectivos genomas haplóide na coluna da direita.

E. coli (bactéria) (1) 1,7 x 108 pb

S. cerevisiae (levedura) (2) 4 x 106 pb

D. melanogaster (mosca de fruta) (3) 3,9 x 109 pb

H. sapiens (homem) (4) 1,4 x 107 pb

15. O que são topoisomerases?

16. O que é o nucleóide de bactérias?

17. O núcleo de uma célula humana tem 6m m de diâmetro e a extensão total do DNA dos seus 46 cromossomos soma 1,8m. Como é resolvida a discrepância entre estas duas grandezas?

18. Esquematize a estrutura do nucleossomo. Qual a característica bioquímica principal das histonas e qual o seu papel na organização da cromatina?

Código Genético e estrutura gênica

1. Baseando-se na lista de códons e amino ácidos abaixo, quais das seguintes afirmações são corretas?

AGU = serina AGC = serina

AAU = asparagina AAC = asparagina

AUG = metionina AUA = isoleucina

a) o código genético é degenerado

b) a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons poderia levar à substituição de uma serina por uma asparagina no polipeptídeo.

c) a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons necessariamente levaria à substituição de um aminoácido no polipeptídeo codificado.

d) um tRNA com o anticódon ACU se ligaria a um ribossomo na presença de um destes códons.

2. Uma globina de 146 aminoácidos sofreu uma mutação no códon correspondente ao sexto aminoácido da cadeia. A análise do DNA indicou uma mudança de (5')TTC(3') para (5')TAC(3') na fita molde. Pergunta-se :

a) A mutação provocou a troca de um aminoácido por outro? Em caso afirmativo, qual é este aminoácido?

c) Quais as implicações para a estrutura da proteína?

c) Qual seria o resultado se a mesma troca ocorresse na base do lado (5')  do DNA?

 

3. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequência

5'...AGGTTACCTAGTTGC...3'

Suponha que um mRNA seja transcrito a partir deste DNA usando a fita complementar como molde. Qual será a seqüência deste mRNA? O que você pode dizer sobre a capacidade de formação de um híbrido RNA-DNA?

4. Qual é a sequência do polipeptídeo que seria codificado pelo mRNA sintetizado na
questão 3. Assuma que o quadro de leitura começa com  o primeiro nucleotídeo.

5. Desenhe a estrutura de um gene de procarioto com seus principais elementos.

6. Desenhe a estrutura de um gene de eucarioto com os seus principais elementos.

7. Defina RNA poli-cistrônico e mono-cistrônico.

8. Como são determinados os genes de um genôma?

 

Replicação/ Mutação e Reparo de DNA

  1. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste experimento se a replicação do DNA fosse conservativa?
  2. Combine as propriedades ou funções na coluna à direita com a DNA polimerase na coluna da esquerda:
  3. (a) DNA polimerase I (1) envolvida na replicação

    (b) DNA polimerase II (2) requer um iniciador e um molde

    (c) DNA polimerase III (3) envolvida no reparo de DNA

    (4) sintetiza a maior parte do DNA durante a replicação

    (5) remove o iniciador e preenche as lacunas durante a replicação

  4. O fragmento de DNA no esquema abaixo é de fita dupla em ambas as extremidades porém de fita simples no meio. A polaridade da fita superior está indicada.
  5. 5'__________________________3'

    __________P    HO_________

    a) O fosfato (P) indicado na fita inferior está na extremidade 5' ou 3' do  fragmento ao qual ele pertence ? (Indique no esquema).

    b) Como você esperaria que a lacuna fosse preenchida pelos processos de reparo do DNA "in vivo" ?

    c) Quantos fragmentos você esperaria encontrar na fita inferior se o experimento fosse realizado "in vitro", na presença de todos os desoxirribonucleotídeos-trifosfato e DNA polimerase?

  6. Explique porque certas variedades mutantes da DNA polimerase I podem apresentar atividade de DNA polimerase praticamente ausente, mas podem ter atividade de exonuclease 5' ® 3' praticamente normal.
  7. Qual a atividade da DNA polimerase III que é responsável pela editoração durante a replicação ?
  8. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas não podem ser replicadas pelo crescimento no mesmo sentido (como mostra a figura abaixo)? Como a célula supera o problema? Esquematize a formação da ligação fosfodiester durante a replicação a partir do nucleotídeo trifosfato livre mostrando o grupo fosfato que é incorporado.
  9.  

     

  10. Descreva brevemente as 3 etapas de reparo por excisão do DNA lesado por luz UV e as enzimas nelas envolvidas.
  11. Como os dímeros de timina podem ser diretamente removidos do DNA?
  12. Como a maquinaria de reparo de E. coli identifica a fita de DNA que tem um nucleotídeo não complementar incorporado durante a replicação?
  13. Visto que U pareia com A tão bem quanto T pareia com A, por que somente T é encontrado no DNA? Esquematize o sistema que repara a substituição C por U.
  14. Explique como algumas cepas da bactéria Salmonella são usadas para detectar substâncias carcinogênicas. Por que extrato de fígado de mamífero está envolvido no teste?

 

Transcrição e Processamento de RNA

1. Dê a composição de subunidades da holoenzima e do cerne da RNA polimerase de E. coli, atribuindo funções às subunidades.

2. Quando uma cultura de E. coli em crescimento é submetida a um rápido aumento de temperatura, um novo e característico conjunto de genes é altamente expresso. Explique como ocorre esta alteração na expressão dos genes.

3. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo nucleotídeo para o crescimento da cadeia polinucleotídica. É necessário um iniciador para a ação da RNA polimerase?

4. Que subunidades da RNA polimerase bacteriana são necessárias para a iniciação da transcrição a partir de um promotor? E para a terminação da transcrição? Explique como uma mutação poderia dar origem a uma E. coli resistente ao antibiótico rifamicina.

5. Uma pequena cadeia de RNA sintetizado in vitro tem a seguinte seqüência:

5'- AUGUACCGAAGUGGUUU - 3'

Coloque os grupos fosfato e um asterisco naqueles que serão radiativos quando a transcrição for feita na presença de [g 32P]-ATP

b) Faça o mesmo para [a 32P]-UTP

6. Defina "promotor", enumere as suas propriedades e diga como podem ser localizados através da técnica de "footprinting".

7. A sequência de um segmento de uma molécula. de DNA duplex é:

(a) 5'-ATCGCTTGTACGGA-3'

(b) 3'-TAGCGAACATGCCT-5'

Quando este segmento serve de molde para a RNA polimerase de E. coli ele dá origem a um segmento de RNA com a seguinte sequência:

(c) 5'-UCCGUACAAGCGAU-3'.

Indique: a) a fita codificadora;

b) a fita senso;

c) a fita molde;

d) a fita anti-senso.

8. Até que ponto o mRNA, rRNA e tRNA são modificados nos procariotos ? Indique as modificações que podem ocorrer.

9. Combine as descrições na coluna da direita com a RNA pol DNA-dependente eucariótica apropriada:

a) RNA pol I (1) localizada no nucléolo

(2) localizada no nucleoplasma

(3) sintetiza hnRNA

b) RNA pol II (4) sintetiza tRNA

(5) sintetiza rRNA

 

(6) sintetiza precursores do rRNA

c) RNA pol III (7) inibida por a -amanitina

(8) sintetiza RNA na direção 5'-3'

(9) composta de várias subunidades

10. Você usaria num paciente, como agente terapêutico anti-bacteriano, qual destes antibióticos: a) rifamicina ou b) actinomicina D ? Justifique a sua escolha.

11. Quais as principais características das sequências de promotores de genes eucarióticos transcritos em mRNAs? Qual a função dos fatores de transcrição e "enhancers"?

12. Em que consiste o terminal 5' cap do mRNA e qual o seu papel ? Qual a característica do terminal 3' encontrado na maioria dos mRNAs de eucariotos e como eles são formados ?

13. Genes de eucariotos são geralmente constituídos de introns e exons. Estas seqüências são tanto transcritas como traduzidas? A remoção dos íntrons (splicing) tem que ser um processo extremamente preciso. Por que? Dê um exemplo de "splicing" aberrante que leva a um tipo de talassemia em humanos.

14. Suponha que o DNA humano é clivado em fragmentos do tamanho aproximado de um mRNA humano maduro e que então são preparados híbridos RNA-DNA. O mesmo procedimento é repetido com E. coli. Quando os híbridos RNA-DNA de cada espécie são examinados ao microscópio eletrônico, qual deles mostra o maior grau de hibridização? Explique e faça um esquema.

15. O mRNA monocistrônico de eucariotos geralmente representa o transcrito primário? E o mRNA dos procariotos? Explique. Faça uma comparação, indicando as principais diferenças encontradas em eucariotos entre um gene, seu transcrito primário e o mRNA maduro que deixa o núcleo para a tradução no citoplasma.

Síntese de Proteínas

1. Dada a semelhança entre valina e isoleucina e a maior concentração de Val em relação a Ile (5:1) em E. coli, os cálculos indicam que a isoleucil-tRNA sintetase deveria incorporar às proteínas, erroneamente, valina em lugar de isoleucina a cada 40 reações. Entretanto, o erro acontece apenas 1 vez em cada 3000 reações. Explique porque.

  1. Como algumas aminoacil-tRNA sintetases podem atingir elevado grau de precisão nas reações, mesmo sem ter um mecanismo hidrolítico de revisão ?
  2. Explique porque as moléculas de tRNA devem ter, concomitantemente, características estruturais particulares e comuns.
  3. Complete: Cada aminoácido é levado aos ribossomos para a síntese de polipeptídeos pelo pareamento de bases entre o _________________ de uma molécula de aminoacil-tRNA e o _____________de um mRNA.
  4. Escreva os produtos finais das seguintes reações:
  5. a) valina + ATP + tRNAVal + valil-tRNA sintetase .

    b) valina + ATP + tRNAIle + isoleucil-tRNA sintetase .

  6. Em um experimento verificou-se que Cys-tRNACys pode ser convertido a Ala-tRNACys e usado num sistema in vitro de síntese de proteínas.
  7. a) Se o Ala-tRNACys for marcado com 14C no aminoácido, a alanina marcada seria incorporada na proteína sintetizada no lugar de outros resíduos Ala ? Explique.

    b) O que o experimento indica sobre a importância da precisão da reação da aminoacil-tRNA sintetase em relação ao processo global da síntese protéica ?

  8. Assumindo que cada nucleosídeo na coluna da esquerda está na primeira posição de um anticódon, com qual(is) nucleotídeo(s) na coluna da direita ele vai parear durante uma interação códon-anticódon, se cada um dos nucleotídeos da direita estiver na terceira posição (3') de um códon ?
  9. anticódon códon

    (a) Adenosina-P (1) Adenosina-P

    (b) Citidina-P (2) Citidina-P

    (c) Guanosina-P (3) Guanosina-P

    (d) Inosina-P (4) Uridina-P

  10. De acordo com o princípio de oscilação no pareamento de bases ("wobble"), qual o número mínimo de tRNAs necessário para decodificar os seis códons de leucina - UUA, UUG, CUU, CUC, CUA e CUG ? Explique.
  11. Uma mutação supressora compensa o efeito de outra mutação num gene distinto do primeiro. Explique como o tRNA poderia estar envolvido neste processo.
  12. Em procariotos, a maioria da cadeias polipeptídicas são iniciadas com o aminoácido ______, cujo códon é ______.
  13. Num sistema de síntese de proteínas in vitro, que permita o início e término da síntese em qualquer sequência de RNA, que peptídeo seria produzido pelo poli-ribonucleotídeo
    5'-UUUGUUUUUGUU-3' ? Indique qual o aminoácido N-terminal e o C-terminal do polipeptídeo obtido.
  14. Qual é o papel da vitamina ácido fólico no processo de tradução em procariotos ?
  15. O códon AUG funciona tanto para iniciar uma cadeia polipeptídica quanto para dirigir a incorporação de uma metionina em posições internas de uma proteína. Quais os mecanismos de seleção do códon AUG para a iniciação da tradução em procariotos ?
  16. Para cada uma das etapas da tradução, descritas abaixo, dê o nucleotídeo trifosfato envolvido como cofator e o número de ligações fosfato de alta energia consumidas.
  17.     a) Ativação do aminoácido

        b) Formação do complexo de iniciação 70S (procariotos) ou 80S (eucariotos)

        c) Entrada do aminoacil-tRNA no ribossomo

        d) Formação da ligação peptídica

        e) Translocação

  18. Os três códons de terminação são ______, _______ e ______.
  19. Muitos antibióticos exercem sua ação por inibição da síntese proteica. Como, então, alguns destes antibióticos podem ser usados em humanos para combater infecções microbianas sem causar efeitos tóxicos devido à inibição da síntese proteica eucariótica?
  20. Considere a seguinte sequência de um fragmento de DNA isolado de bactéria:
  21. 5' CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTTC 3'

    a) Assumindo que esta sequência corresponde a sequência da fita codificadora, qual seria a sequência de aminoácidos do polipeptídeo produzido quando um mRNA transcrito deste gene for traduzido? Que características na sequência do mRNA determinam qual é o códon iniciador? Considere a primeira base como o início da transcrição.

  22. Quais são as características das seqüências sinais que dirigem certos polipeptídeos para o retículo endoplasmático nas células eucarióticas e para secreção em bactérias?

 

Regulação da Expressão Gênica em Procariotos

  1. Defina expressão gênica constitutiva. Compare expressão gênica induzida com repressão gênica. Use o esquema proposto por Jacob e Monod para o operon da lactose e defina os termos operon, gene estrutural, gene regulador, operador, promotor, indutor, repressor e co-repressor.
  2. Numa cultura de E.coli em um meio contendo tanto lactose quanto glicose, qual dos açúcares é metabolizado preferencialmente ? Qual é o mecanismo que permite esta seletividade ? O que acontece quando a glicose se esgota durante o crescimento da bactéria ?
  3. Para o cultivo de E.coli utilizaram-se meios contendo além dos sais necessários, os componentes:
  4. a) lactose d) glicose + cAMP

    b) lactose + glicose e) lactose + glicose + cAMP

    c) glicose

    Analise a produção de b - galactosidase em cada caso, justificando a resposta segundo o modelo de Jacob e Monod.

  5. Qual o efeito da deleção do gene regulador do operon lac? Haveria outro tipo de mutação resultando no mesmo efeito ?
  6. Algumas mutações constitutivas conhecidas no operon da lactose ocorrem no operador(O) ao invés do gene regulador (I).
  7. (a) Você esperaria que um mutante O- seria dominante ou recessivo em relação ao alelo selvagem O+

    (b) A mutação constitutiva no sítio operador atua em cis ou trans ?

    (c) Proponha um experimento envolvendo os genes I+,O-, O+ e Z+ que confirme a sua resposta no ítem (b). Assuma que é possível diferenciar a quantidade de enzima produzida no diploide (++) daquela produzida no haploide (+).

    (d) Mostre de forma análoga se a mutação constitutiva no gene regulador (I-) atua em trans ou em cis.

  8. Uma célula de E. coli que possui um profago l  é imune à infecção lítica por outro fago l . Por que ?

Qual o efeito da deleção do gene CI de l ? Qual o efeito da deleção do gene N de l ?

Regulação da Expressão Gênica em Eucariotos

  1. Compare a expressão gênica em procariotos e eucariotos quanto a:
    1. grau de acoplamento da transcrição e da tradução.
    2. número de produtos gênicos em um transcrito primário.
    3. número de proteínas resultantes da tradução de um transcrito primário.
    4. proporção de seqüências codificadoras no DNA.
    5. organização de genes em operons.
  2. Exemplifique características estruturais exibidas por fatores de transcrição.
  3. A RNA polimerase II, responsável pela síntese dos mRNAs em eucariotos, é incapaz de se ligar aos seus promotores no DNA, a menos que fatores de transcrição estejam ligados na vizinhança destes promotores. O que você espera que aconteça durante o choque térmico em células eucarióticas, quando os genes para as proteínas de choque térmico são fortemente induzidos? Explique.
  4.  

  5. Cromatina que é ativa transcricionalmente (eucromatina) tem estrutura dispersa, enquanto cromatina que é inativa (heterocromatina) é compacta. Quando núcleos de células de galinha produzindo globina foram tratados brevemente com DNase pancreática, os genes de globina de adultos foram seletivamente destruídos, mas os genes para globina embrionica e ovalbumina permaneceram intactos. Quando os núcleos de células de oviduto foram tratadas com DNase, os genes de ovalbumina foram destruídos. Explique estes resultados.
  6.  

  7. Caseína é a proteína mais abundante do leite. É produzida em células epiteliais do tecido mamário em resposta a hormônios, incluindo o hormônio polipeptídico prolactina. Tecido mamário em cultura incubado na ausência de prolactina contém cerca de 300 moléculas de mRNA de caseína por célula, enquanto células incubadas na presença de prolactina contém cerca de 30.000 moléculas de mRNA de caseína. No entanto o núcleo de células de tecido mamário em cultura sintetiza somente cerca de 3 vezes mais mRNA de caseína na presença de prolactina. Proponha uma explicação para estes resultados?
  8.  

  9. Exemplifique como uma cascata de sinalização intracelular pode ser ativada, citando alguns tipos de sinais extracelulares. Como a transcrição de certos genes pode ser influenciada em resposta a um sinal extracelular ?
  10.  

  11. Qual o tipo de modificação covalente reversível em proteínas mais frequente nas cascatas de sinalização intracelular? Quais são as enzimas que catalisam esta modificação ?
  12.  

  13. O cAMP (AMP cíclico) é um importante mensageiro secundário para muitos hormônios. Como pode ocorrer a ativação da enzima adenilato ciclase após ativação de um receptor hormonal?

 

Tecnologia do DNA Recombinante

1. Quando uma molécula de DNA estranha, isto é, de um organismo diferente, entra em certas bactérias o DNA é frequentemente hidrolisado. Explique as bases enzimáticas deste fenômeno de restrição. Explique como o DNA estranho pode as vezes escapar desta hidrólise. Por que o DNA da própria bactéria não sofre hidrólise?

2. Quais das seqüências abaixo são possíveis sítios de reconhecimento de uma enzima de restrição ? Por que ?

(a) 5'-AGTC-3' (b) 5'-ATCG-3'

3'-TCAG-5' 3'-TAGC-5'

(c) 5'-ACCT-3' (d) 5'-ACGT-3'

3'-TGGA-5' 3'-TGCA-5'

3. As enzimas de restrição Hind III e Hae III, que reconhecem e clivam respectivamente as seqüências de DNA:

¯ ¯

(5') AAGCTT (3') (5') GGCC (3')

(3') TTCGAA (5') (3') CCGG (5')

­ ­

foram utilizadas separadamente para clivar a molécula do DNA dupla fita circular abaixo

.... AAGCTTTCAGCAGGCCTA ....

.... TTCGAAAGTCGTCCGGAT ....

Após a clivagem a solução foi aquecida para inativar a enzima de restrição e a solução foi esfriada lentamente após a adição ou não de NaOH 0,1M, para tornar a solução alcalina. Em que condições o DNA assim tratado apresentou-se circular quando observado ao microscópio eletrônico ?

4. Descreva a técnica de Southern. O que a diferencia da técnica de Northern?

5. Qual é a técnica para o estudo simultâneo do nível de expressão de milhares de genes em uma determinada condição fisiológica ?

6. Qual a diferença entre uma biblioteca genômica e uma biblioteca de cDNA. Explique como a presença de íntrons em genes eucarióticos complica a produção de produtos protéicos que eles codificam quando a expressão é feita em bactéria. Como se pode resolver este problema?

7. A partir de uma biblioteca de cDNA você isolou um cDNA completo que codifica para uma proteína que é um potente estimulador do sistema imunológico. Você agora deseja clonar este cDNA em um vetor de expressão para produzir grande quantidade desta proteína em E. coli. O cDNA possui nas suas extremidades sítios para enzima BamHI e você planeja cloná-lo no sítio de BamHI do vetor de expressão. Esta é sua primeira vez com experimentos de clonagem e você decide seguir cuidadosamente as instruções do manual de clonagem, que recomenda que o vetor digerido deve ser tratado com fosfatase alcalina para remover o fosfato da extremidade 5’.

a) Por que deve ser feito o tratamento com fosfatase alcalina?

b) Como você analisaria se a clonagem foi bem sucedida?

c) A proteína de seu interesse afeta o crescimento das bactérias. Como você faria para obter grande quantidade desta proteína recombinante?

 

8. O antígeno que é utilizado na vacina recombinante contra a Hepatite B é uma glicoproteína. Como você imagina que esta proteína recombinante pode ser obtida.

9. O gene completo (contendo todos os exons e íntrons) do hormônio de crescimento de ratos pode ser expresso em camundongos sob o controle de um promotor indutível por Cd2+. Como podem ser obtidos tais camundongos transgênicos? Quais as suas características? Como você explica o fato da expressão do gene do rato ser expresso perfeitamente em camundongos?

10. Descreva o sequenciamento de DNA pelo método de interrupção controlada da replicação (método de Sanger).

11. Suspeita-se que o aminoácido Lisina da posição 272 é essencial para a ação catalítica de uma certa enzima, que pode ser facilmente purificada com atividade a partir de extratos de E.coli expressando a proteína recombinante. Como você investigaria se este aminoácido é de fato essencial para atividade catalítica desta enzima? Que metodologias teria que utilizar?

12. A técnica de PCR (polymerase chain reaction) é utilizada para obter grandes quantidades de DNA a partir de amostras contendo quantidades ínfimas de DNA.

a) Descreva os passos envolvidos nesta técnica.

b) Que tipo de DNA polimerase é normalmente utilizada ?

13. Você deseja amplificar através da técnica de PCR, o DNA contido entre as sequências mostradas na figura abaixo. Escreva a sequência do par de "primers" que você terá que utilizar na reação. Esquematize as reações de polimerização até o terceiro ciclo da amplificação.




5’ GACCTGTGGAAGC CATACGGGATTG 3’

14. A anemia falciforme está associada a existência de uma mutação pontual de A® T, no gene da b -globina que provoca a troca do aminoácido Glu por Val na proteína. Esta mutação elimina um sítio reconhecido pela enzima de restrição MstII. O desenho abaixo representa um esquema dos genes selvagem e mutante. Planeje um teste utilizando a técnica de "Southern blot" para o diagnóstico pré-natal desta doença. Faça o esquema do resultado esperado considerando um feto normal e de um portador da doença cujos pais são heterozigóticos.

 

 

 

Transdução de Sinal e Câncer

  1. Descreva o mecanismo de ativação:
    1. Das Proteínas G pelos receptores serpentina
    2. Da Proteína Quinase A por cAMP
    3. Da liberação de cálcio do retículo por Inositol 1,4,5-trifosfato
    4. Das STATs por receptores de hormônio do crescimento
    5. De Ras por SOS
  2. O que são protooncogenes e oncogenes? Que tipos de proteínas estes genes podem codificar?
  3. A proteína c-Src é homóloga à proteína viral oncogênica conhecida com v-Src e atua como tirosina quinase citossólica, cuja atividade é regulada por fosforilação. Qual a característica de v-Src que a torna uma proteína oncogênica.
  4. A predisposição ao câncer pode ser hereditária. Explique este fato lembrando-se que existem proteínas que agem como supressores do crescimento celular.
  5. Retinoblastoma, um câncer de retina que aflige crianças, está asssociado a uma deleção no cromossomo 13. Proponha uma possível função para o gene selvagem (Rb), que é chamado de anti-oncogene, e codifica uma proteína de 105 kD localizada no núcleo e capaz de se ligar ao DNA.