You are here: HomeQBQ0102Exercícios

QBQ0102 - Exercícios

 

Exercícios de Metabolismo

 

I – Aminoácidos, Proteínas e Enzimas

1. Escrever a fórmula de um aminoácido. Dar exemplos de:

a. aminoácido com um grupo amino e dois grupos carboxílicos

b. aminoácido com um grupo carboxílico e dois grupos aminos.

2. Analisando o radical R, classificar os aminoácidos em polares e apolares. Entre os polares, citar aqueles que, em pH 7, apresentam radical com carga negativa (aminoácidos ácidos), carga positiva (aminoácidos básicos) e carga nula (polares sem carga).

3. Esquematizar a ligação peptídica.

4. Definir proteínas globulares e fibrosas. Citar exemplos.

5. Definir estrutura primária.

6. Descrever as estruturas regulares - alfa-hélice e conformação beta - que compõem a estrutura secundária das proteínas globulares.

7. Definir estrutura terciária de proteínas globulares. Esquematizar os tipos de ligações que a mantêm, indicando os aminoácidos que participam dessas ligações.

8. Definir estrutura quaternária de proteínas globulares. Citar exemplos de proteínas com estrutura quaternária.

9. Verificar a posição dos radicais polares e apolares de uma proteína em solução aquosa.

10 . Definir enzima, substrato e sítio ativo.

11. Definir inibidor competitivo e não-competitivo.

12. Caracterizar enzima alostérica. Definir centro alostérico e efetuador alostérico (positivo e negativo).

13. Definir regulação enzimática por modificação covalente.

14. Definir cofator. Dar exemplos de cofatores inorgânicos (ativadores metálicos) e orgânicos (coenzimas).

15. Representar o grupo ativo de NAD+ e do FAD nas formas reduzida e oxidada.

16. Definir vitaminas, relacionando sua função com atividade enzimática.

 

II - Estrutura de carboidratos e lipídios. Glicólise.

1. Definir carboidrato, açúcar, monossacarídio e oligossacarídio e dar exemplos.

2. Definir polissacarídio. Citar exemplos de polissacarídios estruturais e de reserva.

3. Descrever a estrutura do glicogênio e indicar a porção da molécula que sofre alongamento ou encurtamento.

4. Caracterizar estruturalmente os ácidos graxos mais comuns na natureza.

5. Definir triacilglicerol. Descrever as vantagens para os seres vivos do armazenamento de trialcilgliceróis.

6. Correlacionar a consistência das gorduras animais e óleos vegetais com a estrutura dos ácidos graxos componentes destas substâncias.

7. Definir glicerofosfolipídio e esfingolipídio.

8. Citar as funções do colesterol.

9. Indicar a porção hidrofílica e a porção hidrofóbica dos diferentes tipos de lipídios anfipáticos. Mostrar em que fração celular são comumente encontrados os lipídios anfipáticos.

10. Caracterizar as classes principais de lipoproteínas plasmáticas, indicando a sua função.

11.Responda utilizando apenas o mapa da glicólise.

A. Quais os passos irreversíveis que aparecem no mapa?

B. Quantas moléculas de piruvato se formam a partir de uma molécula de glicose?

C. Que hexose dá origem a trioses?

D. Indicar as reações de óxido-redução que aparecem no mapa.

F. Identificar no mapa as reações catalisadas pelas seguintes enzimas:

a) quinase b) mutase c) isomerase d) aldolase e) desidrogenase

12. Considerando o número de moléculas de ATP consumidas e formadas, estabelecer o saldo final de ATP (balanço energético) na oxidação de uma molécula de glicose pela via glicolítica.

13. Esquematizar as reações de fermentação alcoólica que possibilitam a obtenção de NAD+ na forma oxidada. Citar exemplos de tecidos ou organismos onde ocorrem fermentação lática e alcoólica. Em que condições o músculo oxida glicose a lactato?

 

III - Ciclo de Krebs. Cadeia de Transporte de Elétrons e Fosforilação oxidativa.

1. Escrever a reação de formação de acetil-CoA a partir de piruvato e indicar:

a) as 5 coenzimas necessárias

b) as vitaminas envolvidas

2. Na oxidação de uma molécula de acetil-CoA no ciclo de Krebs, indicar a enzima que catalisa a reação onde há produção ou consumo de:

a) CO2 - b) GTP - c) NADH - d) FADH2 - e) H2O

3. Citar os compostos que fazem parte da cadeia de transporte de elétrons.

4. Esquematizar a seqüência dos compostos da cadeia de transporte de elétrons, indicando os transportadores de elétrons e os transportadores de prótons e elétrons.

5. Citar a localização celular da cadeia de transporte de elétrons.

6. Citar 3 inibidores da cadeia de transporte de elétrons, indicando os transportadores sobre os quais atuam.

7. Definir fosforilação oxidativa. O que está sendo fosforilado? O que está sendo oxidado?

8. Descrever a hipótese do acoplamento quimiosmótico para a fosforilação oxidativa.

9. Indicar o número de ATP sintetizados para cada NADH e FADH2 oxidados.

10. Citar exemplos de processos biológicos que utilizam ATP.

11. Descrever a estrutura da ATP sintase (ou F1F0-ATPase). Descrever a função de cada uma das partes. Onde ela está localizada na mitocôndria?

12. Definir desacoplador e citar um exemplo.

13. Definir inibidor de fosforilação oxidativa e citar um exemplo.

14. A membrana interna da mitocôndria é impermeável a ATP e NADH. Explicar:

a. como o NADH produzido na via glicolítica pode ser oxidado na cadeia respiratória (lançadeiras do malato e de glicerol fosfato).

b. como o ATP produzido na mitocôndria pode ser utilizado no citoplasma.

 

IV - Conversão de sacarídeos, Via das pentoses e Degradação de glicogênio, Biossíntese de carboidratos, Regulação do metabolismo de carboidratos

1. Considerando o número de moléculas de ATP consumidas e formadas, estabelecer o saldo final de ATP (balanço energético) na oxidação de uma molécula de lactose pela via glicolítica.

2. Esquematizar as duas reações de oxidação da via das pentoses, citando as enzimas e as coenzimas envolvidas nestas reações.

3. Definir transaldolase e transcetolase, mostrando a coenzima envolvida. Citar exemplos de reações catalisadas por cada tipo de enzima.

4. Citar a localização celular da via das pentoses.

5. Mostrar a importância biológica da via das pentoses e citar compostos que apresentam ribose na sua molécula.

6. Citar tecidos em que ocorre a via das pentoses.

7. Desenhar as estruturas químicas de NADH e NADPH.

8. Discutir os diferentes papeis de NADH e NADPH.

9. Sugerir a razão pela qual a via das pentoses é muito mais ativa nos adipócitos (onde há alta síntese de ácidos graxos) do que no tecido muscular.

10. Definir polissacarídio. Citar exemplos de polissacarídios estruturais e de reserva.

11. Descrever a estrutura do glicogênio.

12. Esquematizar as reações de degradação do glicogênio a glicose 1-fosfato.

13. Esquematizar as reações de síntese de glicogênio a partir de glicose.

14. Citar a função do glicogênio hepático e do glicogênio muscular.

15. Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Citar o tecido responsável pela gliconeogênese.

16. Comparar as três reações irreversíveis da glicólise com as reações de gliconeogênese que as substituem, quanto a reagentes, produtos, enzimas e coenzimas.

17. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese.

18. Indicar o balanço energético da gliconeogênese se o composto inicial for:

a. piruvato

b. lactato

c. galactose

d. frutose

19. Mostrar a relação entre AMP cíclico e a síntese de glicogênio.

20. Citar os hormônios que estimulam a degradação do glicogênio no fígado e no músculo e mostrar seu modo de ação.

21. Esquematizar as reações catalisadas por adenilato ciclase e fosfodiesterase.

22. Mostrar a relação do AMP cíclico com a degradação do glicogênio a glicose 1-fosfato.

23. Esquematizar as reações de conversão de glicose 1-fosfato a glicose. Citar o tecido onde essas reações ocorrem.

24. Descrever o efeito do glucagon sobre a atividade da fosfofrutoquinase 2 e mostrar a conseqüência deste efeito sobre a atividade da via glicolítica.

25. Fazer um resumo dos efeitos do glucagon, adrenalina e insulina no metabolismo de carboidratos no fígado, musculo e adiposo.

26. Descrever as alterações do metabolismo de carboidratos provocadas por jejum prolongado e por diabetes.

 

V - Metabolismo de ácidos graxos

1. Como os ácidos graxos são transportados no organismo? Como e aonde se dá a ativação do ácido graxo?

2. O que é beta-oxidação?

3. Considerando 1 volta da beta oxidação, qual o produto formado?

4. Compare em rendimento energético, a degradação total de1 mol de um ácido graxo com 18 carbonos e 3 moles de glicose.

5. Localize a degradação de um ácido graxo dentro da célula.

6. O que são corpos cetônicos? Forneça local de produção, de utilização e como são utilizados. Em que condições são formados ?

7. Como a degradação do ácido graxo é regulada?

8. Compare a -oxidação, com a biossíntese do acído decanóico (C10) quanto aos seguintes aspectos. Responda na forma de tabela.

a. Composto de partida

b. Localização intracelular das enzimas que catalizam as reações de ambos os processos.

c. Coenzimas de óxido-redução utilizadas.

d. Carregador de grupo acila

e. Forma em que as unidades de carbonos são removidas ou adicionadas.

f. Saldo de ATP (considere a oxidação até CO2 e H2O)

g. Valor alto da relação ATP/ADP como determinante da ocorrência de uma ou outra.

h. dem valor baixo da relação ATP/ADP.

 

VI - Metabolismo de aminoácidos

1. Como se forma a ureia? De onde vêm os nitrogênios? Qual o órgão envolvido na síntese da uréia?

2. Qual a fonte de carbono da uréia? Como se forma?

3. Forneça a reação de transaminação. Qual a vitamina envolvida? Quais os aminoácidos que não sofrem transaminação?

4. O que são aminoácidos cetogênicos e glicogênicos? Cite 3 exemplos de cada.

De maneira geral, qual o destino dos carbonos e do nitrogênio dos aminoácidos?

Alanina está sendo sintetizada a partir de seus precursores metabólicos.Com os compostos abaixo faça uma tabela com duas colunas.A primeira coluna,com os compostos que são precursores e a segunda, com os compostos que não são precursores da alanina:

- fosfoenol piruvato - glicogênio

- acetil CoA - carbamoil fosfato

- glicose - gliceraldeído-3-fosfato

- malato - malonil CoA

- Ácido palmítico - acetoacetato

 

VII - Integração de metabolismo. Hormônios.

1. Como se dá a regulação do metabolismo de glicogênio por adrenalina? Forneça as principais etapas. Explique. Compare o produto final no fígado e no músculo. 

2. Qual o papel do citrato na regulação do metabolismo de carboidratos e lipídios? Justifique.

3. Considere o metabolismo básico estudado. O que acontece com o metabolismo de lipídios, carboidratos e proteínas após um jejum prolongado? Justifique fornecendo as enzimas e os controles adequados sobre as vias. 

4. Considere o metabolismo básico estudado. O que acontece com o metabolismo de lipídios, carboidratos e proteínas após uma refeição rica em proteínas? Justifique fornecendo as enzimas e os controles adequados sobre as vias. 

5. Abaixo é feita uma série de afirmações referentes a um indivíduo em jejum há dois dias. Considere que o glicogênio hepático está esgotado.Todas as afirmações se referem ao hepatócito.Quando não, no texto é chamada atenção para isto.Preencha a tabela apresentada em seguida as dez primeiras afirmações, agrupando na coluna da esquerda as letras das afirmações que se aplicam e na coluna da direita as letras das afirmações que não se aplicam a situação fisiológica do jejum.

a. A produção de uréia é baixa

b. Verifica-se baixa produção de NADPH, ou mesmo não se verifica.

c. A glicogênio sintetase está na sua forma defosforilada, isto é ativa.

d. Glicose-6-fosfatase encontra-se em atividade, isto é produzindo glicose livre.

e. Acetil Côa proveniente da intensa beta-oxidação dos ácidos graxos está sendo utilizada na síntese de corpos cetônicos.

f. No citossol não se encontra malonil Coa.

g. Verifica-se níveis altos de insulina plasmática.

h. Verifica-se metabolização de glicose-6-fosfato pela glicólise.

i. Está ocorrendo intensa beta-oxidação de ácidos graxos de tal forma que não há oxalacetato suficiente para colocar não ciclo de Krebs o produto desta beta-oxidação.

j. A glicose-6-fosfato no citossol é utilizada na síntese de glicogênio.

 

 

Exercícios de Biologia Molecular

 

VIII - Estrutura e Função dos Ácidos Nucleicos, Código Genético e estrutura gênica

1. Quais as diferenças de composição e estrutura entre RNA e DNA. Como se distingue entre a uracila e a timina, e entre a ribose e a desoxirribose. 

2. Escreva a estrutura da 5' - desoxiadenosina trifosfato (dATP). Especifique o tipo de ligação entre: (a) a base nitrogenada e o açúcar; (b) o açúcar e o fosfato; (c) os fosfatos ±,  e Ž . 

3. Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequência: 

(5') ATGCCGTATGCATTGCATTC (3')

Exprima, em porcentagem, a composição de bases do DNA de fita dupla.

4. Como são chamadas as ligações covalentes que unem dois nucleotídeos consecutivos nas moléculas de ácidos nucleicos? Esquematize estas ligações. 

5. RNA é facilmente hidrolizado por álcali, enquanto DNA não é. Por que? 

6. Explique por que os ácidos nucleicos são desnaturados quando submetidos a alta temperatura ou pHs extremos? Como estas moléculas podem ser renaturadas? 

7. Defina Temperatura de fusão (Tm) e efeito hipercrômico. 

8. O valor de Tm para o DNA pode ser calculado usando-se a fórmula : 

Tm = 69,3 + 0,41(%GC), onde GC é a porcentagem de Guanina + Citosina

a. DNA de E. coli contém 50% GC. Calcular o Tm para o DNA desta bactéria. 

b. As curvas de fusão da maioria dos DNAs que ocorrem naturalmente revelam que o Tm é normalmente maior do que 65oC. Por que isto é importante para a maioria dos organismos? 

c. Como varia o Tm com a força iônica da solução? 

d. O que acontece com Tm quando se adiciona etanol à solução de DNA?

9. Quais as principais características da dupla-hélice de DNA de acordo com o modelo proposto por Watson e Crick? 

10. Descreva os principais experimentos que indicaram que o DNA é o material genético.

11. O que são topoisomerases?

12. O núcleo de uma célula humana tem 6ºm de diâmetro e a extensão total do DNA dos seus 46 cromossomos soma 1,8m. Como é resolvida a discrepância entre estas duas grandezas?

13. Esquematize a estrutura do nucleossomo. Qual a característica bioquímica principal das histonas e qual o seu papel na organização da cromatina?

14 . Baseando-se na lista de códons e amino ácidos abaixo, quais das seguintes afirmações são corretas?

AGU = serina AGC = serina

AAU = asparagina AAC = asparagina

AUG = metionina AUA = isoleucina

a. o código genético é degenerado

b. a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons poderia levar à substituição de uma serina por uma asparagina no polipeptídeo.

c. a alteração de um único nucleotídeo no DNA que dirige a síntese destes códons necessariamente levaria à substituição de um aminoácido no polipeptídeo codificado.

d. um tRNA com o anticódon ACU se ligaria a um ribossomo na presença de um destes códons.

15. Uma globina de 146 aminoácidos sofreu uma mutação no códon correspondente ao sexto aminoácido da cadeia. A análise do DNA indicou uma mudança de (5')TTC(3') para (5')TAC(3') na fita molde. Pergunta-se :

a. A mutação provocou a troca de um aminoácido por outro? Em caso afirmativo, qual é este aminoácido? 

b. Quais as implicações para a estrutura da proteína? 

c. Qual seria o resultado se a mesma troca ocorresse na base do lado (5') do DNA?

16. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequência

5'...AGGTTACCTAGTTGC...3'

Suponha que um mRNA seja transcrito a partir deste DNA usando a fita complementar como molde. Qual será a seqüência deste mRNA? O que você pode dizer sobre a capacidade de formação de um híbrido RNA-DNA?

17. Qual é a sequência do polipeptídeo que seria codificado pelo mRNA sintetizado na 

questão 3. Assuma que o quadro de leitura começa com o primeiro nucleotídeo.

18. Desenhe a estrutura de um gene de procarioto com seus principais elementos.

19. Desenhe a estrutura de um gene de eucarioto com os seus principais elementos. 

20. Defina RNA poli-cistrônico e mono-cistrônico.

 

IX - Replicação/ Mutação e Reparo de DNA. Transcrição e Processamento de RNA.

1. Combine as propriedades ou funções na coluna à direita com a DNA polimerase na coluna da esquerda: 

(a) DNA polimerase I (1) envolvida na replicação

(b) DNA polimerase II (2) requer um iniciador e um molde

(c) DNA polimerase III (3) envolvida no reparo de DNA

(4) sintetiza a maior parte do DNA durante a replicação

(5) remove o iniciador e preenche as lacunas durante a replicação

2. O fragmento de DNA no esquema abaixo é de fita dupla em ambas as extremidades porém de fita simples no meio. A polaridade da fita superior está indicada. 

5'__________________________3'

__________P HO_________

a. O fosfato (P) indicado na fita inferior está na extremidade 5' ou 3' do fragmento ao qual ele pertence ? (Indique no esquema).

b. Como você esperaria que a lacuna fosse preenchida pelos processos de reparo do DNA "in vivo" ?

c. Quantos fragmentos você esperaria encontrar na fita inferior se o experimento fosse realizado "in vitro", na presença de todos os desoxirribonucleotídeos-trifosfato e DNA polimerase?

3. Qual a atividade da DNA polimerase III que é responsável pela editoração durante a replicação ? 

4. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas não podem ser replicadas pelo crescimento no mesmo sentido (como mostra a figura abaixo)? Como a célula supera o problema? Esquematize a formação da ligação fosfodiester durante a replicação a partir do nucleotídeo trifosfato livre mostrando o grupo fosfato que é incorporado. 

 

5. Descreva brevemente as 3 etapas de reparo por excisão do DNA lesado por luz UV e as enzimas nelas envolvidas. 

6. Como a maquinaria de reparo de E. coli identifica a fita de DNA que tem um nucleotídeo não complementar incorporado durante a replicação? 

7. Visto que U pareia com A tão bem quanto T pareia com A, por que somente T é encontrado no DNA? Esquematize o sistema que repara a substituição C por U. 

8. . Dê a composição de subunidades da holoenzima e do cerne da RNA polimerase de E. coli, atribuindo funções às subunidades. 

9. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo nucleotídeo para o crescimento da cadeia polinucleotídica. É necessário um iniciador para a ação da RNA polimerase?

10. Que subunidades da RNA polimerase bacteriana são necessárias para a iniciação da transcrição a partir de um promotor? E para a terminação da transcrição? Explique como uma mutação poderia dar origem a uma E. coli resistente ao antibiótico rifamicina.

11. Uma pequena cadeia de RNA sintetizado in vitro tem a seguinte seqüência:

5'- AUGUACCGAAGUGGUUU - 3'

a. Coloque os grupos fosfato e um asterisco naqueles que serão radiativos quando a transcrição for feita na presença de [g 32P]-ATP

b. Faça o mesmo para [a 32P]-UTP

12. Defina "promotor", enumere as suas propriedades e diga como podem ser localizados através da técnica de "footprinting".

13. A sequência de um segmento de uma molécula. de DNA duplex é:

(a) 5'-ATCGCTTGTACGGA-3'

(b) 3'-TAGCGAACATGCCT-5'

Quando este segmento serve de molde para a RNA polimerase de E. coli ele dá origem a um segmento de RNA com a seguinte sequência:

(c) 5'-UCCGUACAAGCGAU-3'.

Indique: 

a. a fita codificadora;

b. a fita senso;

c. a fita molde;

14. Quais as principais características das sequências de promotores de genes eucarióticos transcritos em mRNAs? Qual a função dos fatores de transcrição e "enhancers"?

15. Em que consiste o terminal 5' cap do mRNA e qual o seu papel ? Qual a característica do terminal 3' encontrado na maioria dos mRNAs de eucariotos e como eles são formados ?

16. Genes de eucariotos são geralmente constituídos de introns e exons. Estas seqüências são tanto transcritas como traduzidas? A remoção dos íntrons (splicing) tem que ser um processo extremamente preciso. Por que? Dê um exemplo de "splicing" aberrante que leva a um tipo de talassemia em humanos. 

17. Suponha que o DNA humano é clivado em fragmentos do tamanho aproximado de um mRNA humano maduro e que então são preparados híbridos RNA-DNA. O mesmo procedimento é repetido com E. coli. Quando os híbridos RNA-DNA de cada espécie são examinados ao microscópio eletrônico, qual deles mostra o maior grau de hibridização? Explique e faça um esquema.

18. O mRNA monocistrônico de eucariotos geralmente representa o transcrito primário? E o mRNA dos procariotos? Explique. Faça uma comparação, indicando as principais diferenças encontradas em eucariotos entre um gene, seu transcrito primário e o mRNA maduro que deixa o núcleo para a tradução no citoplasma.

 

X - Síntese de Proteínas

1. Escreva os produtos finais das seguintes reações: 

a. valina + ATP + tRNAVal + valil-tRNA sintetase .

b. valina + ATP + tRNAIle + isoleucil-tRNA sintetase .

2. Em um experimento verificou-se que Cys-tRNACys pode ser convertido a Ala-tRNACys e usado num sistema in vitro de síntese de proteínas. 

a. Se o Ala-tRNACys for marcado com 14C no aminoácido, a alanina marcada seria incorporada na proteína sintetizada no lugar de outros resíduos Ala ? Explique.

b. O que o experimento indica sobre a importância da precisão da reação da aminoacil-tRNA sintetase em relação ao processo global da síntese protéica ?

3. De acordo com o princípio de oscilação no pareamento de bases ("wobble"), qual o número mínimo de tRNAs necessário para decodificar os seis códons de leucina - UUA, UUG, CUU, CUC, CUA e CUG ? Explique. 

4. Em procariotos, a maioria da cadeias polipeptídicas são iniciadas com o aminoácido ______, cujo códon é ______. 

5. Num sistema de síntese de proteínas in vitro, que permita o início e término da síntese em qualquer sequência de RNA, que peptídeo seria produzido pelo poli-ribonucleotídeo 

5'-UUUGUUUUUGUU-3' ? Indique qual o aminoácido N-terminal e o C-terminal do polipeptídeo obtido. 

6. O códon AUG funciona tanto para iniciar uma cadeia polipeptídica quanto para dirigir a incorporação de uma metionina em posições internas de uma proteína. Quais os mecanismos de seleção do códon AUG para a iniciação da tradução em procariotos ? 

7. Para cada uma das etapas da tradução, descritas abaixo, dê o nucleotídeo trifosfato envolvido como cofator e o número de ligações fosfato de alta energia consumidas. 

a. Ativação do aminoácido 

b. Formação do complexo de iniciação 70S (procariotos) ou 80S (eucariotos)

c. Entrada do aminoacil-tRNA no ribossomo

d. Formação da ligação peptídica

e.Translocação 

8. Os três códons de terminação são ______, _______ e ______. 

9. Considere a seguinte sequência de um fragmento de DNA isolado de bactéria: 

5' CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTTC 3'

Assumindo que esta sequência corresponde a sequência da fita codificadora, qual seria a sequência de aminoácidos do polipeptídeo produzido quando um mRNA transcrito deste gene for traduzido? Que características na sequência do mRNA determinam qual é o códon iniciador? Considere a primeira base como o início da transcrição.

 

About


Dr. Glaucia Souza holds a degree from the Biosciences Institute of University of São Paulo  (1988), PhD in Biochemistry at the Institute of Chemistry  (1993), post-doctorate in molecular genetics at La Jolla Cancer Research Foundation  (1994) and post-doctorate in molecular genetics at Baylor College of Medicine  (1996).

Post-doctoral position for two years at University of São Paulo, Brazil